pEGFP-C1-FLAG-Ku80
(Plasmid #46958)

• Purpose: Plasmid for expression of GFP-FLAG tagged human Ku80 (N-terminal tag). Confers resistance to G418.
• Depositing Lab: Steve Jackson
• Publication: Britton et al J Cell Biol. 2013 Jul 29.

Backbone

• Vector backbone: pEGFP-C1-FLAG
• Backbone size w/o insert (bp): 4766
• Total vector size (bp): 6912
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ku80
• Alt name: XRCC5
• Species: H. sapiens (human)
• Insert Size (bp): 2199
• GenBank ID: NM_021141.3
• Entrez Gene: XRCC5 (a.k.a. KARP-1, KARP1, KU80, KUB2, Ku86, NFIV)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP-FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: GCAAGTAAAACCTCTACAAATGTGG

Resource Information

• Supplemental Documents:
  • Author annotated GenBank sequence
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositor notes that the D158G point mutation does not affect plasmid function.