pEGFP-C1-FLAG-Ku70
(Plasmid #46957)

• Purpose: Plasmid for cloning and epression of GFP-FLAG tagged human Ku70 (N-terminal tag). Confers resistance to G418.
• Depositing Lab: Steve Jackson
• Publication: Britton et al J Cell Biol. 2013 Jul 29.

Backbone

• Vector backbone: pEGFP-C1-FLAG
• Backbone size w/o insert (bp): 4766
• Total vector size (bp): 6543
• Modifications to backbone: Inserted a FLAG tag and XhoI and NotI unique restriction sites between BglII and HindIII.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ku70
• Alt name: XRCC6
• Species: H. sapiens (human)
• Insert Size (bp): 1830
• GenBank ID: NM_001469.3
• Entrez Gene: XRCC6 (a.k.a. CTC75, CTCBF, G22P1, KU70, ML8, TLAA)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP-FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: GCAAGTAAAACCTCTACAAATGTGG

Resource Information

• Supplemental Documents:
  • Author annotated GenBank sequence
• Articles Citing this Plasmid:
  • 10 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry