YFP-Parkin C431N
(Plasmid #46924)

• Purpose: expresses mutant Parkin with YFP tag in mammalian cells
• Depositing Lab: Richard Youle
• Publication: Lazarou et al J Cell Biol. 2013 Jan 21;200(2):163-72. doi: 10.1083/jcb.201210111. Epub 2013 Jan 14.

Backbone

• Vector backbone: pEYFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4698
• Total vector size (bp): 6096
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Park2
• Alt name: Parkin
• Species: H. sapiens (human)
• Insert Size (bp): 1398
• Mutation: changed cysteine 431 to asparagine
• GenBank ID: NM_004562
• Entrez Gene: PRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
• Promoter: CMV
• Tag / Fusion Protein:
  • EYFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: AGAAGCGCGATCACATGG
• 3′ sequencing primer: CTACAAATGTGGTATGGCTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry