pRK5-Myc-SH3BP4 W92A
(Plasmid
#46892)
-
Purposeexpresses Myc tagged SH3BP4 W92A mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRK5-myc
-
Backbone manufacturerclonetch
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSH3BP4 W92A
-
Alt nameBOG25
-
Alt nameSH3-domain binding protein 4
-
Alt nameSH3BP4
-
SpeciesH. sapiens (human)
-
MutationW92A (mutated SH3 domain)
-
Entrez GeneSH3BP4 (a.k.a. BOG25, TTP)
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer SP6
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer:
cacatctggcggtgaggcgtggtacgcacacaac
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5-Myc-SH3BP4 W92A was a gift from Do-Hyung Kim (Addgene plasmid # 46892 ; http://n2t.net/addgene:46892 ; RRID:Addgene_46892) -
For your References section:
SH3BP4 is a negative regulator of amino acid-Rag GTPase-mTORC1 signaling. Kim YM, Stone M, Hwang TH, Kim YG, Dunlevy JR, Griffin TJ, Kim DH. Mol Cell. 2012 Jun 29;46(6):833-46. doi: 10.1016/j.molcel.2012.04.007. Epub 2012 May 9. 10.1016/j.molcel.2012.04.007 PubMed 22575674