-
PurposeLentiviral vector encoding Tet-inducible mitochondrially targeted myc-tagged E.coli exonuclease III
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMA2780
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 6686
- Total vector size (bp) 7545
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameexonucleaseIII E. coli
-
Alt nameexoIII
-
SpeciesE. coli
-
Insert Size (bp)950
- Promoter TRE-Tight
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ctatagtgaatagagttagg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA2775 was a gift from Mikhail Alexeyev (Addgene plasmid # 46884 ; http://n2t.net/addgene:46884 ; RRID:Addgene_46884) -
For your References section:
Persistent damage induces mitochondrial DNA degradation. Shokolenko IN, Wilson GL, Alexeyev MF. DNA Repair (Amst). 2013 Jul;12(7):488-99. doi: 10.1016/j.dnarep.2013.04.023. Epub 2013 May 27. 10.1016/j.dnarep.2013.04.023 PubMed 23721969