pMA2775
(Plasmid #46884)

• Purpose: Lentiviral vector encoding Tet-inducible mitochondrially targeted myc-tagged E.coli exonuclease III
• Depositing Lab: Mikhail Alexeyev
• Publication: Shokolenko et al DNA Repair (Amst). 2013 Jul;12(7):488-99. doi: 10.1016/j.dnarep.2013.04.023. Epub 2013 May 27.

Backbone

• Vector backbone: pMA2780
• Backbone manufacturer: Homemade
• Backbone size w/o insert (bp): 6686
• Total vector size (bp): 7545
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: exonucleaseIII E. coli
• Alt name: exoIII
• Species: E. coli
• Insert Size (bp): 950
• Promoter: TRE-Tight
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ctatagtgaatagagttagg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry