Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMA3431
(Plasmid #46876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46876 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMA3211
  • Backbone size w/o insert (bp) 6642
  • Total vector size (bp) 8700
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    soluble guanylate cyclase 1alpha 3
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2137
  • Mutation
    R592Q
  • Entrez Gene
    Gucy1a3 (a.k.a. Gucy1a1, SGC)
  • Promoter TRE-Tight
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ctatagtgaatagagttagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Open Biosystems

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA3431 was a gift from Mikhail Alexeyev & Troy Stevens (Addgene plasmid # 46876 ; http://n2t.net/addgene:46876 ; RRID:Addgene_46876)
  • For your References section:

    Pseudomonas aeruginosa exotoxin Y is a promiscuous cyclase that increases endothelial tau phosphorylation and permeability. Ochoa CD, Alexeyev M, Pastukh V, Balczon R, Stevens T. J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25. 10.1074/jbc.M111.301440 PubMed 22637478