pMA3383
(Plasmid
#46875)
-
PurposeA retroviral vector for the constitutive expression of soluble guanylate cyclase1 beta3
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMA1662
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 5684
- Total vector size (bp) 7527
-
Vector typeRetroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesoluble guanylate cyclase 1beta 3
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1880
-
Entrez GeneGucy1b3
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer agccctttgtacaccctaag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA was purchased from Open Biosystems (Huntsville, AL; catalogue No. 7104600)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA3383 was a gift from Mikhail Alexeyev & Troy Stevens (Addgene plasmid # 46875 ; http://n2t.net/addgene:46875 ; RRID:Addgene_46875) -
For your References section:
Pseudomonas aeruginosa exotoxin Y is a promiscuous cyclase that increases endothelial tau phosphorylation and permeability. Ochoa CD, Alexeyev M, Pastukh V, Balczon R, Stevens T. J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25. 10.1074/jbc.M111.301440 PubMed 22637478