pMA3379
(Plasmid #46874)

• Purpose: A lentiviral vector for the doxycycline-inducible expression of soluble guanylate cyclase1 alpha3
• Depositing Labs: Mikhail Alexeyev, Troy Stevens
• Publication: Ochoa et al J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25.

Backbone

• Vector backbone: pMA3211
• Backbone manufacturer: Homemade
• Backbone size w/o insert (bp): 6642
• Total vector size (bp): 8766
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: soluble guanylate cyclase 1alpha3
• Species: R. norvegicus (rat)
• Insert Size (bp): 2184
• Entrez Gene: Gucy1a3 (a.k.a. Gucy1a1, SGC)
• Promoter: TRE-Tight
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (destroyed during cloning)
• 3′ cloning site: NotI (destroyed during cloning)
• 5′ sequencing primer: ctatagtgaatagagttagg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cDNA was purchased from Open Biosystems

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that though there are some differences between Addgene's quality control sequence and the depositor's assembled sequence, this plasmid should function as reported.