pFA3
(Plasmid #46790)

• Purpose: To express ATPase inactive Fun30 in budding yeast
• Depositing Lab: Patrick Varga-Weisz
• Publication: Neves-Costa et al PLoS One. 2009 Dec 1;4(12):e8111. doi: 10.1371/journal.pone.0008111.

Backbone

• Vector backbone: pYES2.1/V5-His/lacZ
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 8964
• Total vector size (bp): 12690
• Modifications to backbone: The vector used for galactose-induced yeast expression of C-terminal double tagged (V5 and 6xHis) proteins was the pYES2.1/V5-His-TOPO (Invitrogen) and cloning was according to the manufacturer’s specifications. The identity of the cloned material was confirmed by restriction digestion analysis and DNA sequencing. PFA3 contains the ATPase-inactive version of Fun30, which carries a point mutation in the ATPase domain (Corona et al, 1999) that replaces lysine at position 603 (AAA) by arginine (AGA). The point mutation was introduced with the kit QuickChange XL Site-Directed Mutagenesis (Stratagene), according to the manufacturer’s specifications. The template was PFA1 and the primers were Mut forward (CGACATGGGTCTAGGTAGAACATGTCAAGTCATTTC) and Mut reverse (GAAATGACTTGACATGTTCTACCTAGACCCATGTCG).
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FUN30
• Alt name: YAL019W
• Species: S. cerevisiae (budding yeast)
• Mutation: ATP-binding site mutated replaced lysin 603 by arginine (AAA to AGA)
• Entrez Gene: FUN30 (a.k.a. YAL019W)
• Promoter: PGAL1
• Tag / Fusion Protein:
  • V5 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sal1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: T7

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry