pFA1
(Plasmid #46789)

• Purpose: To express Fun30 in trans in budding yeast
• Depositing Lab: Patrick Varga-Weisz
• Publication: Neves-Costa et al PLoS One. 2009 Dec 1;4(12):e8111. doi: 10.1371/journal.pone.0008111.

Backbone

• Vector backbone: pYES2.1/V5-His/lacZ
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 8964
• Total vector size (bp): 12690
• Modifications to backbone: The vector used for galactose-induced yeast expression of C-terminal double tagged (V5 and 6xHis) proteins was the pYES2.1/V5-His-TOPO (Invitrogen) and cloning was according to the manufacturer’s specifications. The identity of the cloned material was confirmed by restriction digestion analysis and DNA sequencing. PFA1 contains the full-length wild-type Fun30 sequence. The coding region of Fun30, including the 2 codons immediately upstream of the sequence and excluding the stop codon were amplified by polymerase chain reaction (PCR) from purified genomic DNA using the enzyme PfuUltra (Stratagene) following the manufacturer’s specifications. The primers used were: forward F30 (GTCGACGAAAACATGAGTGGTTCG) and reverse F30 (CTCGAGTTCTTTGGTTCCCTTCGG), which introduced a SalI and an XhoI restriction enzyme sites in the fragment amplified, in the 5’- and 3’- ends, respectively. 3’adenylation of the amplified fragments was done by PCR, after which the TOPO cloning reaction was performed.
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FUN30
• Alt name: YAL019W
• Species: S. cerevisiae (budding yeast)
• Entrez Gene: FUN30 (a.k.a. YAL019W)
• Promoter: PGAL1
• Tag / Fusion Protein:
  • V5 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sal1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: T7

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry