PCMV-intron myc Rab1a S25N
(Plasmid #46777)

• Purpose: expression of S25N Rab1a in mammalian cells
• Depositing Lab: Terry Hébert
• Publication: Dupre et al J Biol Chem. 2006 Nov 10;281(45):34561-73. Epub 2006 Sep 7.

Backbone

• Vector backbone: pCMV-intron myc
• Modifications to backbone: intron-myc inserted HindIII/XbaI. Intron enhances stability of mRNA.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rab1a S25N mutant
• Alt name: member RAS oncogene family
• Alt name: Rab1a
• Species: H. sapiens (human)
• Mutation: S25N (dominant negative)
• Entrez Gene: RAB1A (a.k.a. RAB1, YPT1)
• Promoter: CMV
• Tag / Fusion Protein:
  • myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: BGH Reverse

Resource Information

• Supplemental Documents:
  • Rab1a S25N sequence
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

cDNA was obtained from UMR cDNA Resource Center, www.cdna.org

To make mutation, the following primers were used for PCR amplification:
Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′)
BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)