5xGAL4-TATA-luciferase
(Plasmid #46756)

• Purpose: Luciferase reporter gene for factors with GAL4 DNA binding domains
• Depositing Lab: Richard Maurer
• Publication: Sun et al Genes Dev. 1994 Nov 1;8(21):2527-39.

Backbone

• Vector backbone: pSV232AL-AD5
• Total vector size (bp): 6300
• Modifications to backbone: delete SV40 promoter and add 2xSV40 polyadenylation sits, 5xGAL4 binding sites and a minimal TATA promoter upstream of luciferase
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Luciferase
• Species: Firefly
• Insert Size (bp): 1729
• Promoter: minimal TATA

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TGTGTCAGAGGTTTTCACCGT
• 3′ sequencing primer: CGAAAAGTGCCACCTGACGTCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: DR Helinski University of California San Diego
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

de Wet et al, MCB, 7: 725-737, 1987.

Note that there are some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These differences should not affect plasmid function.