pGEX-6p-2-EWSR1
(Plasmid
#46384)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX-6p-2
-
Backbone manufacturerAmersham
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 7500
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEWSR1
-
Alt nameEWS
-
Alt nameEWS RNA-binding protein 1 isoform CRA_e
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2600
-
Entrez GeneEWSR1 (a.k.a. EWS, EWS-FLI1, bK984G1.4)
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pGEX5'
- 3′ sequencing primer pGEX3' (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The EWS cDNA23 was PCR-amplified using primers
ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-6p-2-EWSR1 was a gift from Heinz Gehring (Addgene plasmid # 46384 ; http://n2t.net/addgene:46384 ; RRID:Addgene_46384) -
For your References section:
Different methylation characteristics of protein arginine methyltransferase 1 and 3 toward the Ewing Sarcoma protein and a peptide. Pahlich S, Bschir K, Chiavi C, Belyanskaya L, Gehring H. Proteins. 2005 Oct 1;61(1):164-75. 10.1002/prot.20579 PubMed 16044463