pENTR SD Age HsSAS-6
(Plasmid #46381)

• Purpose: For expression of C-terminal fusions.
• Depositing Lab: Pierre Gonczy
• Publication: Kitagawa et al Cell. 2011 Feb 4;144(3):364-75. doi: 10.1016/j.cell.2011.01.008.

Backbone

• Vector backbone: pENTR1A
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2717
• Total vector size (bp): 4224
• Modifications to backbone: The multiple cloning site of pENTR 1A was modified by introducing single restriction sites between the attR1 and attR2 sites (3-AgeI and XbaI-5), generating the entry vector pENTR-SD-Age-AGT
• Vector type: Entry vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SAS-6
• Alt name: SASS6
• Alt name: spindle assembly 6 homolog (C. elegans)
• Species: H. sapiens (human)
• Insert Size (bp): 2000
• Entrez Gene: SASS6 (a.k.a. MCPH14, SAS-6, SAS6)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: pENTR-F
• 3′ sequencing primer: pENTR-R

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Full length HsSAS-6 was amplified using the primers Age-Ko-HsSAS6-F (CGCGACCGGTACCATGAGCCAAGTGCTGTTCCAC) and Xba-noST-S6-R (CGCGTCTAGATAACTGTTTGGTAACTGCCCA), and cloned into pENTR-SD-Age vector by restriction digest with AgeI and XbaI.