Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENTR SD Age HsSAS-6
(Plasmid #46381)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46381 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENTR1A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2717
  • Total vector size (bp) 4224
  • Modifications to backbone
    The multiple cloning site of pENTR 1A was modified by introducing single restriction sites between the attR1 and attR2 sites (3-AgeI and XbaI-5), generating the entry vector pENTR-SD-Age-AGT
  • Vector type
    Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SAS-6
  • Alt name
    SASS6
  • Alt name
    spindle assembly 6 homolog (C. elegans)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Entrez Gene
    SASS6 (a.k.a. MCPH14, SAS-6, SAS6)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer pENTR-F
  • 3′ sequencing primer pENTR-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Full length HsSAS-6 was amplified using the primers Age-Ko-HsSAS6-F (CGCGACCGGTACCATGAGCCAAGTGCTGTTCCAC) and Xba-noST-S6-R (CGCGTCTAGATAACTGTTTGGTAACTGCCCA), and cloned into pENTR-SD-Age vector by restriction digest with AgeI and XbaI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR SD Age HsSAS-6 was a gift from Pierre Gonczy (Addgene plasmid # 46381 ; http://n2t.net/addgene:46381 ; RRID:Addgene_46381)
  • For your References section:

    Structural basis of the 9-fold symmetry of centrioles. Kitagawa D, Vakonakis I, Olieric N, Hilbert M, Keller D, Olieric V, Bortfeld M, Erat MC, Fluckiger I, Gonczy P, Steinmetz MO. Cell. 2011 Feb 4;144(3):364-75. doi: 10.1016/j.cell.2011.01.008. 10.1016/j.cell.2011.01.008 PubMed 21277013