pTK165_Mem-mCherry-4.1G-CTD
(Plasmid #46362)

• Depositing Lab: Iain Cheeseman
• Publication: Kiyomitsu et al Cell. 2013 Jul 18;154(2):391-402. doi: 10.1016/j.cell.2013.06.010.

Backbone

• Vector backbone: pEGFP-C1
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 5183
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 4.1G C-terminal domain
• Species: H. sapiens (human)
• Mutation: C-terminal domain from 886-1005 amino acids
• Entrez Gene: EPB41L2 (a.k.a. 4.1-G, 4.1G)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Mem (N-terminal 20 amino acids of neuromodulin for membrane targeting) (N terminal on backbone)
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI