pTK162_mCherry-4.1G-hardened
(Plasmid
#46361)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 7838
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name4.1G
-
SpeciesH. sapiens (human)
-
MutationModified for siRNA resistance to gcTccTcaTttCgaAcgGacAAGC
-
Entrez GeneEPB41L2 (a.k.a. 4.1-G, 4.1G)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK162_mCherry-4.1G-hardened was a gift from Iain Cheeseman (Addgene plasmid # 46361 ; http://n2t.net/addgene:46361 ; RRID:Addgene_46361) -
For your References section:
Cortical dynein and asymmetric membrane elongation coordinately position the spindle in anaphase. Kiyomitsu T, Cheeseman IM. Cell. 2013 Jul 18;154(2):391-402. doi: 10.1016/j.cell.2013.06.010. 10.1016/j.cell.2013.06.010 PubMed 23870127