pTK158_mCherry-4.1G-deltaCTD-hardened
(Plasmid #46360)

• Depositing Lab: Iain Cheeseman
• Publication: Kiyomitsu et al Cell. 2013 Jul 18;154(2):391-402. doi: 10.1016/j.cell.2013.06.010.

Backbone

• Vector backbone: pEGFP-C1
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 7478
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 4.1G
• Species: H. sapiens (human)
• Mutation: Deleted amino acids 886-1005, and modified for siRNA resistance to gcTccTcaTttCgaAcgGacAAGC
• Entrez Gene: EPB41L2 (a.k.a. 4.1-G, 4.1G)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry