Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIhh-5A9-LUC
(Plasmid #46318)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46318 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Luc reporter vector
  • Backbone manufacturer
    Yang lab
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    5 copies of A9 sequence from Ihh promoter
  • Alt name
    indian hedgehog
  • Alt name
    Ihh
  • Insert Size (bp)
    135
  • Promoter mouse osteocalcin gene 2 promoter
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ?
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIhh-5A9-LUC was a gift from Xiangli Yang (Addgene plasmid # 46318 ; http://n2t.net/addgene:46318 ; RRID:Addgene_46318)
  • For your References section:

    Atf4 regulates chondrocyte proliferation and differentiation during endochondral ossification by activating Ihh transcription. Wang W, Lian N, Li L, Moss HE, Wang W, Perrien DS, Elefteriou F, Yang X. Development. 2009 Dec;136(24):4143-53. doi: 10.1242/dev.043281. Epub 2009 Nov 11. 10.1242/dev.043281 PubMed 19906842