Skip to main content
Addgene

pGEX-4T-1-p19-T7-Vif
(Plasmid #46313)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46313 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGEX-4T-1
  • Backbone size w/o insert (bp) 4941
  • Total vector size (bp) 6719
  • Vector type
    Bacterial Expression ; pro-siRNA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    p19
  • Species
    Tomato bushy stunt virus
  • Insert Size (bp)
    519
  • GenBank ID
    AJ288942
  • Tags / Fusion Proteins
    • GST (N terminal on backbone)
    • 6XHis (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Vif DNA-1
  • Species
    HIV-1
  • Insert Size (bp)
    577

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer ATGGAACGAGCTATACAAGGA
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
    • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    linker
  • Species
    Synthetic
  • Insert Size (bp)
    32

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer ATGGAACGAGCTATACAAGGA
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
    • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Vif DNA-2
  • Species
    HIV-1
  • Insert Size (bp)
    577

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ATGGAACGAGCTATACAAGGA
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.

More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-4T-1-p19-T7-Vif was a gift from Judy Lieberman (Addgene plasmid # 46313 ; http://n2t.net/addgene:46313 ; RRID:Addgene_46313)

  • For your References section:

    Efficient and specific gene knockdown by small interfering RNAs produced in bacteria. Huang L, Jin J, Deighan P, Kiner E, McReynolds L, Lieberman J. Nat Biotechnol. 2013 Apr;31(4):350-6. doi: 10.1038/nbt.2537. Epub 2013 Mar 10. 10.1038/nbt.2537 PubMed 23475073
Related items:
Commonly requested with: