pGEX-4T-1-p19-T7-EGFP100
(Plasmid
#46309)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46309 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX-4T-1
- Backbone size w/o insert (bp) 4941
- Total vector size (bp) 5765
-
Vector typeBacterial Expression ; pro-siRNA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namep19
-
SpeciesTomato bushy stunt virus
-
Insert Size (bp)519
-
GenBank IDAJ288942
-
Tags
/ Fusion Proteins
- GST (N terminal on backbone)
- 6XHis (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP100 DNA-1
-
SpeciesSynthetic
-
Insert Size (bp)100
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer ATGGAACGAGCTATACAAGGA
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namelinker
-
SpeciesSynthetic
-
Insert Size (bp)32
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer ATGGAACGAGCTATACAAGGA
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameEGFP100 DNA-2
-
SpeciesSynthetic
-
Insert Size (bp)100
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATGGAACGAGCTATACAAGGA
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.
More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-4T-1-p19-T7-EGFP100 was a gift from Judy Lieberman (Addgene plasmid # 46309 ; http://n2t.net/addgene:46309 ; RRID:Addgene_46309) -
For your References section:
Efficient and specific gene knockdown by small interfering RNAs produced in bacteria. Huang L, Jin J, Deighan P, Kiner E, McReynolds L, Lieberman J. Nat Biotechnol. 2013 Apr;31(4):350-6. doi: 10.1038/nbt.2537. Epub 2013 Mar 10. 10.1038/nbt.2537 PubMed 23475073
Map uploaded by the depositor.