pcDNA3-FLAG-HA-CAD S1859A
(Plasmid
#46239)
-
PurposeFLAG-HA-CAD with S1859 phosphorylation site mutated to alanine
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46239 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 12345
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
-
Alt nameCAD
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6943
-
MutationSerine 1859 changed to Alanine (S1859A)
-
GenBank IDNM_023525
-
Entrez GeneCad (a.k.a. 2410008J01Rik, AU018859, Cpad)
- Promoter cmv
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer tgctgatgtcattgtgctccga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-FLAG-HA-CAD S1859A was a gift from Brendan Manning (Addgene plasmid # 46239 ; http://n2t.net/addgene:46239 ; RRID:Addgene_46239) -
For your References section:
Stimulation of de novo pyrimidine synthesis by growth signaling through mTOR and S6K1. Ben-Sahra I, Howell JJ, Asara JM, Manning BD. Science. 2013 Mar 15;339(6125):1323-8. doi: 10.1126/science.1228792. Epub 2013 Feb 21. 10.1126/science.1228792 PubMed 23429703