pQUASp-mCD8mCherry
(Plasmid #46164)

• Purpose: Expression of murine CD8mCherry in insects
• Depositing Lab: Christopher Potter
• Publication: pQUASp plasmids for germline expression (unpublished)

Backbone

• Vector backbone: pQUASp
• Backbone size w/o insert (bp): 9929
• Total vector size (bp): 11309
• Vector type: Insect Expression
• Selectable markers: white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCD8mCherry
• Alt name: mouse CD8
• Alt name: mCherry
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 1380

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TTTGAAAACCGGTGATAGAGCCTG
• 3′ sequencing primer: ACCAGGGGATGCTTAATTGTGTTC

Resource Information

• Supplemental Documents:
  • pQUASP-mCD8mCherry.gb
• A portion of this plasmid was derived from a plasmid made by: Denise Montell, UC Santa Barbara
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry