-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUASp
- Backbone size (bp) 9909
-
Modifications to backboneRemoved UAS enhancers and replaced with 15 copies of QUAS enhancer elements
-
Vector typeInsect Expression
-
Selectable markerswhite
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pCasper-F
- 3′ sequencing primer ACCAGGGGATGCTTAATTGTGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQUASp was a gift from Christopher Potter (Addgene plasmid # 46162 ; http://n2t.net/addgene:46162 ; RRID:Addgene_46162) -
For your References section:
Organization of olfactory centres in the malaria mosquito Anopheles gambiae. Riabinina O, Task D, Marr E, Lin CC, Alford R, O'Brochta DA, Potter CJ. Nat Commun. 2016 Oct 3;7:13010. doi: 10.1038/ncomms13010. 10.1038/ncomms13010 PubMed 27694947
Map uploaded by the depositor.
