pCasper4-tubulin-IVS-Syn21-QSco-p10
(Plasmid #46132)

• Depositing Lab: Christopher Potter
• Publication: Riabinina et al Nat Methods. 2015 Jan 12. doi: 10.1038/nmeth.3250.

Backbone

• Vector backbone: pCasper4-tubulinP
• Backbone size w/o insert (bp): 11431
• Total vector size (bp): 14067
• Modifications to backbone: Introduced IVS and Syn21 into 5' UTR. Removed SV40 terminator, and replaced with p10 terminator.
• Vector type: Insect Expression
• Selectable markers: white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: QSco
• Alt name: QS codon optimized
• Species: Synthetic
• Insert Size (bp): 2757

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tubP-F:TTTCTATGCTGCTGGAACGC

Resource Information

• Supplemental Documents:
  • pCasper4-tubulin-IVS-Syn21-QSco-p10.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 5036 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid.

Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.