Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCaSpeR4-tubulin-QF#7m1
(Plasmid #46128)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46128 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCaSpeR4
  • Backbone size w/o insert (bp) 7743
  • Total vector size (bp) 11717
  • Modifications to backbone
    Inserted tubulin promoter
  • Vector type
    Insect Expression
  • Selectable markers
    white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    QF#7m1
  • Alt name
    QF#7 activation domain m1
  • Alt name
    QF DNA binding domain
  • Alt name
    QF2 with modified activation domain 1
  • Species
    Synthetic
  • Insert Size (bp)
    1062

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer tubP-F:TTTCTATGCTGCTGGAACGC
  • 3′ sequencing primer hsp70REV-SEQ:GCAAACTCACTCCCTGACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCaSpeR4-tubulin-QF#7m1 was a gift from Christopher Potter (Addgene plasmid # 46128 ; http://n2t.net/addgene:46128 ; RRID:Addgene_46128)
  • For your References section:

    Improved and expanded Q-system reagents for genetic manipulations. Riabinina O, Luginbuhl D, Marr E, Liu S, Wu MN, Luo L, Potter CJ. Nat Methods. 2015 Jan 12. doi: 10.1038/nmeth.3250. 10.1038/nmeth.3250 PubMed 25581800