pCaSpeR4-tubulin-QF#7
(Plasmid #46127)

• Depositing Lab: Christopher Potter
• Publication: Riabinina et al Nat Methods. 2015 Jan 12. doi: 10.1038/nmeth.3250.

Backbone

• Vector backbone: pCaSpeR4
• Backbone size w/o insert (bp): 7743
• Total vector size (bp): 11700
• Modifications to backbone: Inserted tubulin promoter
• Vector type: Insect Expression
• Selectable markers: white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: QF#7
• Alt name: QF DNA binding domain
• Alt name: QF Activation Domain
• Alt name: QF2
• Species: Synthetic
• Insert Size (bp): 1053

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: tubP-F:TTTCTATGCTGCTGGAACGC
• 3′ sequencing primer: hsp70REV-SEQ:GCAAACTCACTCCCTGACA

Resource Information

• Supplemental Documents:
  • pCasper4-tubulin-QF#7 GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 4899 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid.

Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.