pattB-synaptobrevin-GAL4-hsp70
(Plasmid #46107)

• Depositing Lab: Christopher Potter
• Publication: Riabinina et al Nat Methods. 2015 Jan 12. doi: 10.1038/nmeth.3250.

Backbone

• Vector backbone: pattB
• Total vector size (bp): 12217
• Modifications to backbone: Introduced synaptobrevin promoter
• Vector type: Insect Expression
• Selectable markers: white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GAL4
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2646

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: AatII (not destroyed)
• 5′ sequencing primer: TGGAAGACAGTGAAAGAGGC
• 3′ sequencing primer: GCAAACTCACTCCCTGACA

Resource Information

• Supplemental Documents:
  • pattB-synaptobrevin-GAL4-hsp70.gb
• A portion of this plasmid was derived from a plasmid made by: Liqun Luo, Stanford University
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.