Skip to main content
Addgene

pNMHCII-C1C2-GFP
(Plasmid #46044)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46044 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 10900
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nonmuscle myosin heavy chain II-C, isoform C1C2
  • Alt name
    NMHCII-C, isoform C1C2
  • Alt name
    Myh14, isoform C1C2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    6153
  • GenBank ID
  • Entrez Gene
    Myh14 (a.k.a. 2400004E04Rik, II-C, NHMCII, NMHC II-C)
  • Promoter CMV immediate early
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV-for: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer EGFP-N: CGTCGCCGTCCAGCTCGACCAG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNMHCII-C1C2-GFP was a gift from Robert Adelstein (Addgene plasmid # 46044 ; http://n2t.net/addgene:46044 ; RRID:Addgene_46044)

  • For your References section:

    An alternatively spliced isoform of non-muscle myosin II-C is not regulated by myosin light chain phosphorylation. Jana SS, Kim KY, Mao J, Kawamoto S, Sellers JR, Adelstein RS. J Biol Chem. 2009 Apr 24;284(17):11563-71. doi: 10.1074/jbc.M806574200. Epub 2009 Feb 23. 10.1074/jbc.M806574200 PubMed 19240025
Related items:
Commonly requested with: