pNMHCII-C2-GFP
(Plasmid
#46043)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 10800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenonmuscle myosin heavy chain II-C, isoform C2
-
Alt nameNMHCII-C, isoform C2
-
Alt nameMyh14, isoform C2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6129
-
GenBank IDEF602040 NM_001271538
-
Entrez GeneMyh14 (a.k.a. 2400004E04Rik, II-C, NHMCII, NMHC II-C)
- Promoter CMV immediate early
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV-for: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer EGFP-N: CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNMHCII-C2-GFP was a gift from Robert Adelstein (Addgene plasmid # 46043 ; http://n2t.net/addgene:46043 ; RRID:Addgene_46043) -
For your References section:
An alternatively spliced isoform of non-muscle myosin II-C is not regulated by myosin light chain phosphorylation. Jana SS, Kim KY, Mao J, Kawamoto S, Sellers JR, Adelstein RS. J Biol Chem. 2009 Apr 24;284(17):11563-71. doi: 10.1074/jbc.M806574200. Epub 2009 Feb 23. 10.1074/jbc.M806574200 PubMed 19240025
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/96/18/091de006-cd4b-11e2-82d2-003048dd6500.pdf.940x940_q85_autocrop.png)