Skip to main content
Addgene

pNMHCII-C0-GFP
(Plasmid #46040)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46040 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 10700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nonmuscle myosin heavy chain II-C, isoform C0
  • Alt name
    NMHCII-C, isoform C0
  • Alt name
    Myh14, isoform C0
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    6006
  • GenBank ID
    AY205605 NM_028021
  • Entrez Gene
    Myh14 (a.k.a. 2400004E04Rik, II-C, NHMCII, NMHC II-C)
  • Promoter CMV immediate early
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV-for: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer EGFP-N: CGTCGCCGTCCAGCTCGACCAG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNMHCII-C0-GFP was a gift from Robert Adelstein (Addgene plasmid # 46040 ; http://n2t.net/addgene:46040 ; RRID:Addgene_46040)

  • For your References section:

    A specific isoform of nonmuscle myosin II-C is required for cytokinesis in a tumor cell line. Jana SS, Kawamoto S, Adelstein RS. J Biol Chem. 2006 Aug 25;281(34):24662-70. Epub 2006 Jun 21. 10.1074/jbc.M604606200 PubMed 16790446
Related items:
Commonly requested with: