pOSIP-KO (KanR, 186)
(Plasmid #45985)

• Purpose: (Empty Backbone)
• Depositing Labs: Drew Endy, Keith Shearwin
• Publication: St-Pierre et al ACS Synth Biol. 2013 Sep 20;2(9):537-41. doi: 10.1021/sb400021j. Epub 2013 May 20.

Backbone

• Vector backbone: pOSIP
• Backbone size (bp): 6472
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DB3.1
• Growth instructions: Contains ccdB, so must be grown in a strain resistant to this product (e.g. DB3.1). Growth a 30C to repress expression of the integrase.
• Copy number: High Copy

Cloning Information

• 5′ sequencing primer: TAAACTGCCAGGAATTGGGGATC
• 3′ sequencing primer: GAAACGCAAAAAGGCCATCCGTC

Resource Information

• Supplemental Documents:
  • pOSIP-KO annotated sequence
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Plasmid was in part derived from: Haldimann, A. & Wanner, B. L. Conditional-replication, integration, excision, and retrieval plasmid-host systems for gene structure-function studies of bacteria. J. Bacteriol. 183, 6384–6393 (2001).
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there is a E59G mutation in Integrase 186.

Addgene has sequence verified this plasmid using multiple sequencing methods, however, Addgene has observed mixed digest results with some restriction enzymes. Additionally, Addgene has also found that this plasmid may be prone to multimerization. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.

Reference:
St-Pierre F, Cui L et al., "One-step cloning and chromosomal integration of DNA", ACS Synthetic Biology, http://pubs.acs.org/doi/abs/10.1021/sb400021j