pOSIP-KL (KanR, Lambda)
(Plasmid #45984)

• Purpose: (Empty Backbone)
• Depositing Labs: Drew Endy, Keith Shearwin
• Publication: St-Pierre et al ACS Synth Biol. 2013 Sep 20;2(9):537-41. doi: 10.1021/sb400021j. Epub 2013 May 20.

Backbone

• Vector backbone: pOSIP
• Backbone size (bp): 6764
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DB3.1
• Growth instructions: Contains ccdB, so must be grown in a strain resistant to this product (e.g. DB3.1). Growth a 30C to repress expression of the integrase.
• Copy number: High Copy

Cloning Information

• 5′ sequencing primer: TAAACTGCCAGGAATTGGGGATC
• 3′ sequencing primer: GAAACGCAAAAAGGCCATCCGTC

Resource Information

• Supplemental Documents:
  • pOSIP-KL annotated sequence
• A portion of this plasmid was derived from a plasmid made by: Plasmid was in part derived from: Haldimann, A. & Wanner, B. L. Conditional-replication, integration, excision, and retrieval plasmid-host systems for gene structure-function studies of bacteria. J. Bacteriol. 183, 6384–6393 (2001).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Reference:
St-Pierre F, Cui L et al., "One-step cloning and chromosomal integration of DNA", ACS Synthetic Biology, http://pubs.acs.org/doi/abs/10.1021/sb400021j