pCMV-Rab-Rep
(Plasmid
#45967)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMVbeta
-
Backbone manufacturerClontech
- Total vector size (bp) 7371
-
Modifications to backboneRabZFN target sites inserted
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebeta-Galactosidase
-
SpeciesE. coli
-
Insert Size (bp)3500
-
Mutationduplicated aa 1-135
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (destroyed during cloning)
- 3′ cloning site NruI (destroyed during cloning)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Rab-Rep was a gift from Ralf Kuehn (Addgene plasmid # 45967 ; http://n2t.net/addgene:45967 ; RRID:Addgene_45967)