pHsp70-Cas9
(Plasmid #45945)

• Purpose: The codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy number.
• Depositing Labs: Melissa Harrison, Kate O'Connor-Giles, Jill Wildonger
• Publication: Gratz et al Genetics. 2013 May 24.

Backbone

• Vector backbone: pHSS6
• Backbone size w/o insert (bp): 2300
• Modifications to backbone: Cas9 was cloned into pHSS6hsILMi20 (Pavlopoulos et al., 2004) between the hsp70 promoter and 3'UTR using ClaI (5') and XbaI (3').
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Codon optimized Cas9
• Alt name: SpCas9
• Insert Size (bp): 4272
• Mutation: Silent change from C to A at bp 834 of insert
• Tag / Fusion Protein:
  • 3x FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ctgcagtaaagtgcaagttaaagtg
• 3′ sequencing primer: cccatatgttataacccattgatgaac

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Feng Zhang, Broad Institute, MIT
• Articles Citing this Plasmid:
  • 18 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information on FlyCRISPR Plasmids and a list of related plasmids please refer to: http://www.addgene.org/crispr/OConnor-Giles/

Plasmid 51019: pDsRed-attP (www.addgene.org/51019) can be for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site.