-
Purposecaveolar protein, confines caveolae to the plasma membrane
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmEGFP-N-DEST
-
Backbone manufacturerClontech/ custom-made
- Backbone size w/o insert (bp) 4745
- Total vector size (bp) 6374
-
Modifications to backbonepmEGFP-N-DEST was created by the ligation of the Gateway cassette as HindIII/AgeI fragment into pmEGFP-N1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEps-15 homology domain-containing protein2
-
Alt nameEHD2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1629
-
GenBank IDNM_014601.3
-
Entrez GeneEHD2 (a.k.a. PAST2)
- Promoter CMV
-
Tag
/ Fusion Protein
- monomeric EGFP_FrameN1 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gttttcccagtcacgacgttgtaaaacgacggccagt
- 3′ sequencing primer ccctatagtgagtcgtattacatggtcatagctgtttcctgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EHD2-mEGFP was a gift from Ari Helenius (Addgene plasmid # 45932 ; http://n2t.net/addgene:45932 ; RRID:Addgene_45932) -
For your References section:
Oligomers of the ATPase EHD2 confine caveolae to the plasma membrane through association with actin. Stoeber M, Stoeck IK, Hanni C, Bleck CK, Balistreri G, Helenius A. EMBO J. 2012 May 16;31(10):2350-64. doi: 10.1038/emboj.2012.98. Epub 2012 Apr 13. 10.1038/emboj.2012.98 PubMed 22505029