-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLEU
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCP-2x-yeGFP
-
Alt nameMS2 coat protein
-
Insert Size (bp)1994
- Promoter MET25
-
Tag
/ Fusion Protein
- 2x-yeGFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATGGCACGTGAAGCTGTCG
- 3′ sequencing primer GGCCGCAAATTAAAGCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDZ274 (pLEU MET25pro MCP-2x-yeGFP) was a gift from Robert Singer & Daniel Zenklusen (Addgene plasmid # 45929 ; http://n2t.net/addgene:45929 ; RRID:Addgene_45929) -
For your References section:
Single-molecule analysis of gene expression using two-color RNA labeling in live yeast. Hocine S, Raymond P, Zenklusen D, Chao JA, Singer RH. Nat Methods. 2013 Feb;10(2):119-21. doi: 10.1038/nmeth.2305. Epub 2012 Dec 23. 10.1038/nmeth.2305 PubMed 23263691
Map uploaded by the depositor.