pMRXIP GFP-Stx17 WT
(Plasmid #45909)

• Depositing Lab: Noboru Mizushima
• Publication: Itakura et al Cell. 2012 Dec 7;151(6):1256-69. doi: 10.1016/j.cell.2012.11.001.

Backbone

• Vector backbone: pMRXIP GFP-Ci2
• Backbone manufacturer: Dr.Shoji Yamaoka of Tokyo Medical and Dental University
• Backbone size w/o insert (bp): 6600
• Total vector size (bp): 7506
• Vector type: Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Syntaxin 17
• Species: H. sapiens (human)
• Insert Size (bp): 906
• GenBank ID: NM_017919.2
• Entrez Gene: STX17
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA
• 3′ sequencing primer: AAAAGACGGCAATATGGTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: It has the pMX backbone
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry