pCRII-Topo Inhba
(Plasmid
#45868)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4500
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameInhba in situ probe
-
Alt nameInhba
-
Alt nameinhibin beta-A
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)506
-
Mutationnt 428-933 from Inhba mRNA (NM_008380.1)
-
GenBank IDNM_008380
-
Entrez GeneInhba
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Inhba fragment was amplified by RT-PCR using the following primer pair:
GCGATCAGAAAGCTTCATGTG
AGACTGGCACCACTCTCCTG
For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo Inhba was a gift from Jeffrey Macklis (Addgene plasmid # 45868 ; http://n2t.net/addgene:45868 ; RRID:Addgene_45868) -
For your References section:
Novel subtype-specific genes identify distinct subpopulations of callosal projection neurons. Molyneaux BJ, Arlotta P, Fame RM, MacDonald JL, MacQuarrie KL, Macklis JD. J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009. 10.1523/JNEUROSCI.6108-08.2009 PubMed 19793993
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/92/22/bb7ba462-c7a7-11e2-a3c0-003048dd6500.png.940x940_q85_autocrop.png)