Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRII-Topo Frmd4b
(Plasmid #45867)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45867 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4600
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Frmd4b in situ probe
  • Alt name
    Frmd4b
  • Alt name
    Grsp1
  • Alt name
    GSP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    603
  • Mutation
    contains bp# 3933-4535 of NM_145148.2
  • GenBank ID
    NM_145148
  • Entrez Gene
    Frmd4b (a.k.a. 6030440G05Rik, C87375, GOBLIN, GRSP1, R74720)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Frmd4b fragment was amplified by RT-PCR using the following primer pair:
AGCTCCTGAATCGTGGCTTA
TCCTGCAGCTCGGAGTAAAT

For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 3933-4535 of NM_145148.2, not bp# 3856-4458 as indicated on plasmid map as indicated on plasmid map as indicated on plasmid map. The plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Frmd4b was a gift from Jeffrey Macklis (Addgene plasmid # 45867 ; http://n2t.net/addgene:45867 ; RRID:Addgene_45867)
  • For your References section:

    Novel subtype-specific genes identify distinct subpopulations of callosal projection neurons. Molyneaux BJ, Arlotta P, Fame RM, MacDonald JL, MacQuarrie KL, Macklis JD. J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009. 10.1523/JNEUROSCI.6108-08.2009 PubMed 19793993