pCRII-Topo Btg1
(Plasmid #45865)

• Depositing Lab: Jeffrey Macklis
• Publication: Molyneaux et al J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4600
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Btg1 in situ probe
• Alt name: Btg1
• Alt name: B cell translocation gene 1, anti-proliferative
• Species: M. musculus (mouse)
• Insert Size (bp): 635
• Mutation: contains bp# 1004-1638 of BC006834.1
• GenBank ID: NM_007569
• Entrez Gene: Btg1 (a.k.a. AI426953, AW546738)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Bgt1 fragment was amplified by RT-PCR using the following primer pair:
TGCCATAGTTTGGACAGTACC
CAAAATAGATGGTGGTTTGTGG

For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 1004-1638 when compared to BC006834.1, not bp# 1004-1638 as indicated on plasmid map as indicated on plasmid map. The plasmid functions as described in the associated publication.