Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLPCX-PECAMTL
(Plasmid #45851)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45851 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLPCX
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 6265
  • Total vector size (bp) 10047
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PECAM1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3800
  • Entrez Gene
    PECAM1 (a.k.a. CD31, CD31/EndoCAM, GPIIA', PECA1, PECAM-1, endoCAM)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Compared to the current NCBI reference sequence for PECAM1, this plasmid has a V125L substitution. This is a known SNP. Also, two silent mutations were introduced to destroy two internal EcoRI sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPCX-PECAMTL was a gift from Martin Schwartz (Addgene plasmid # 45851 ; http://n2t.net/addgene:45851 ; RRID:Addgene_45851)
  • For your References section:

    Fluid Shear Stress on Endothelial Cells Modulates Mechanical Tension across VE-Cadherin and PECAM-1. Conway DE, Breckenridge MT, Hinde E, Gratton E, Chen CS, Schwartz MA. Curr Biol. 2013 May 14. pii: S0960-9822(13)00490-9. doi: 10.1016/j.cub.2013.04.049. 10.1016/j.cub.2013.04.049 PubMed 23684974