pBabe HA-Runx1-neo
(Plasmid #45815)

• Depositing Lab: Kevin Janes
• Publication: Wang et al Proc Natl Acad Sci U S A. 2011 Oct 4;108(40):E803-12. doi: 10.1073/pnas.1103423108. Epub 2011 Aug 22.

Backbone

• Vector backbone: pBabe neo
• Backbone manufacturer: Weinberg Lab (Addgene plasmid 1767)
• Backbone size w/o insert (bp): 5300
• Total vector size (bp): 6600
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Runx1
• Alt name: AML1
• Alt name: runt related transcription factor 1
• Alt name: Cbfa2
• Species: M. musculus (mouse)
• Insert Size (bp): 1347
• GenBank ID: NM_0011110022
• Entrez Gene: Runx1 (a.k.a. AML1, CBF-alpha-2, Cbfa2, Pebp2a2, Pebpa2b)
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pBABE 5'
• 3′ sequencing primer: pBABE 3'

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse).
The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated.