pBabe DN-FOXO1-HA neo
(Plasmid #45814)

• Depositing Lab: Kevin Janes
• Publication: Wang et al Proc Natl Acad Sci U S A. 2011 Oct 4;108(40):E803-12. doi: 10.1073/pnas.1103423108. Epub 2011 Aug 22.

Backbone

• Vector backbone: pBabe neo
• Backbone manufacturer: Weinberg Lab (Addgene plasmid 1767)
• Backbone size w/o insert (bp): 5300
• Total vector size (bp): 6000
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FOXO1
• Alt name: forkhead box O1
• Alt name: FKH1
• Alt name: FKHR
• Species: H. sapiens (human)
• Insert Size (bp): 792
• Mutation: aa1-255
• GenBank ID: NM_002015
• Entrez Gene: FOXO1 (a.k.a. FKH1, FKHR, FOXO1A)
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: pBABE 5'
• 3′ sequencing primer: pBABE 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: William Sellers, Harvard Medical School (now at Novartis)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBabe DN-FOXO1-HA-neo was constructed by PCR using a pBabe FOXO1 template (Nakamura N, et al. (2000) Mol Cell Biol 20(23):8969-8982) and the following primers: GCGCGGATCCATGGCCGAGGCGCCTCAG (forward), GCGCGTCGACTTAAGCGTAGTCTGGGACGTCGTATGGGTATGCAGCTCTTCTCCTAGGAG (reverse).
The PCR product was gel purified, digested with BamHI and SalI, and then ligated into pBabe neo, which had been digested with BamHI and SalI and then dephosphorylated.