TN-XXL pRSETB
(Plasmid #45796)

• Purpose: Fluorescent reporter for calcium signaling
• Depositing Lab: Oliver Griesbeck
• Publication: Mank et al Nat Methods. 2008 Sep;5(9):805-11. doi: 10.1038/nmeth.1243.

Backbone

• Vector backbone: pRSETB
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 4750
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TN-XXL
• Species: G. gallus (chicken)
• Insert Size (bp): 1885
• Promoter: T7
• Tags / Fusion Proteins:
  • 6xHIS (N terminal on backbone)
  • ECFP (N terminal on insert)
  • YFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGGTGAGCAAGGGCGAGGAG
• 3′ sequencing primer: cgtcacaacattgaggattga

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

TN-XXL is composed of two fluorescent proteins: cyan fluorescent protein (CFP) as the FRET donor and cpCitrine as the FRET acceptor. These proteins are linked by the calcium-sensitive double C-terminal lobe of troponin C (TnC). After the binding of free calcium, TnC undergoes a reversible conformational change that leads to energy transfer from the donor to the acceptor fluorophore, resulting in a drop in CFP fluorescence and an increase in cpCitrine fluorescence.