Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TN-XXL pRSETB
(Plasmid #45796)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45796 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRSETB
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 4750
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TN-XXL
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    1885
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHIS (N terminal on backbone)
    • ECFP (N terminal on insert)
    • YFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGGTGAGCAAGGGCGAGGAG
  • 3′ sequencing primer cgtcacaacattgaggattga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TN-XXL is composed of two fluorescent proteins: cyan fluorescent protein (CFP) as the FRET donor and cpCitrine as the FRET acceptor. These proteins are linked by the calcium-sensitive double C-terminal lobe of troponin C (TnC). After the binding of free calcium, TnC undergoes a reversible conformational change that leads to energy transfer from the donor to the acceptor fluorophore, resulting in a drop in CFP fluorescence and an increase in cpCitrine fluorescence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TN-XXL pRSETB was a gift from Oliver Griesbeck (Addgene plasmid # 45796 ; http://n2t.net/addgene:45796 ; RRID:Addgene_45796)
  • For your References section:

    A genetically encoded calcium indicator for chronic in vivo two-photon imaging. Mank M, Santos AF, Direnberger S, Mrsic-Flogel TD, Hofer SB, Stein V, Hendel T, Reiff DF, Levelt C, Borst A, Bonhoeffer T, Hubener M, Griesbeck O. Nat Methods. 2008 Sep;5(9):805-11. doi: 10.1038/nmeth.1243. 10.1038/nmeth.1243 PubMed 19160515