Skip to main content
Addgene

MG-miR125b-sponge-bulge
(Plasmid #45790)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45790 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    MSCV EGFP (MG vector)
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR125b sponge
  • Promoter MSCV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NOT1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer caccctaagcctccgcctcctct
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MG-miR125b-sponge-bulge was a gift from David Baltimore (Addgene plasmid # 45790 ; http://n2t.net/addgene:45790 ; RRID:Addgene_45790)

  • For your References section:

    Oncomir miR-125b regulates hematopoiesis by targeting the gene Lin28A. Chaudhuri AA, So AY, Mehta A, Minisandram A, Sinha N, Jonsson VD, Rao DS, O'Connell RM, Baltimore D. Proc Natl Acad Sci U S A. 2012 Mar 13;109(11):4233-8. doi: 10.1073/pnas.1200677109. Epub 2012 Feb 24. 10.1073/pnas.1200677109 PubMed 22366319
Related items:
Commonly requested with: