pBEST-p15a-pBAD-TetO1-UTR1-deGFP-ssrA-T500
(Plasmid
#45788)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBEST-Luc
-
Backbone manufacturerPromega
-
Modifications to backbonepTacI promoter was removed and replaced by pBAD-tetO1 (repressed by TetR). Untranslated region was removed and replaced by UTR1, a powerful UTR. Luc gene (firefly Luciferase) was removed and replaced by deGFP, ssrA tagged. A transcriptional terminator was added, called T500.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedeGFP
-
Alt nameeGFP-Del6-229
-
SpeciesSynthetic
-
Insert Size (bp)675
- Promoter pBAD-tetO1
-
Tag
/ Fusion Protein
- ssrA degradation tag
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATGGTGAAGACTATCGCAC
- 3′ sequencing primer GAAGGAGCTGACTGGGTTGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVincent Noireaux, University of Minnesota
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEST-p15a-pBAD-TetO1-UTR1-deGFP-ssrA-T500 was a gift from Richard Murray (Addgene plasmid # 45788 ; http://n2t.net/addgene:45788 ; RRID:Addgene_45788)
