Skip to main content
Addgene

pBEST-p15a-PLtetO-1-UTR1-LacI-T500
(Plasmid #45784)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45784 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBEST-Luc
  • Backbone manufacturer
    Promega
  • Modifications to backbone
    pTacI promoter was removed and replaced by the promoter PLtetO-1. Untranslated region was removed and replaced by UTR1, a powerful UTR. Luc gene (firefly Luciferase) was removed and replaced by LacI. A transcriptional terminator was added, called T500.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Lac repressor
  • Alt name
    LacI
  • Insert Size (bp)
    1083
  • Promoter PLtetO-1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CATGGTGAAGACTATCGCAC
  • 3′ sequencing primer GAAGGAGCTGACTGGGTTGA
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vincent Noireaux, University of Minnesota

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEST-p15a-PLtetO-1-UTR1-LacI-T500 was a gift from Richard Murray & Vincent Noireaux (Addgene plasmid # 45784 ; http://n2t.net/addgene:45784 ; RRID:Addgene_45784)

  • For your References section:

    Linear DNA for rapid prototyping of synthetic biological circuits in an Escherichia coli based TX-TL cell-free system. Sun ZZ, Yeung E, Hayes CA, Noireaux V, Murray RM. ACS Synth Biol. 2014 Jun 20;3(6):387-97. doi: 10.1021/sb400131a. Epub 2013 Dec 4. 10.1021/sb400131a PubMed 24303785
Related items:
Commonly requested with: