pCRII-Topo Nnmt in situ probe
(Plasmid
#45631)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4400
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNnmt in situ probe
-
Alt nameNnmt
-
Alt namenicotinamide N-methyltransferase
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)455
-
Mutationfragment contains bp# 454-908 of NM_010924.2
-
GenBank IDNM_010924
-
Entrez GeneNnmt
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Nnmt fragment was amplified by RT-PCR using the following primer pair:
CCTATGTGTGTGATCTTGAAGG
AGATCTGCCTGGCTTTCG
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 454-908 of NM_010924.2 (and contain a single nucleotide mismatch at bp#816), not bp# 529-983 as indicated on plasmid map. The plasmid functions as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo Nnmt in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45631 ; http://n2t.net/addgene:45631 ; RRID:Addgene_45631) -
For your References section:
Novel subtype-specific genes identify distinct subpopulations of callosal projection neurons. Molyneaux BJ, Arlotta P, Fame RM, MacDonald JL, MacQuarrie KL, Macklis JD. J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009. 10.1523/JNEUROSCI.6108-08.2009 PubMed 19793993
Map uploaded by the depositor.