pCRII-Topo Nnmt in situ probe
(Plasmid #45631)

• Depositing Lab: Jeffrey Macklis
• Publication: Molyneaux et al J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4400
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Nnmt in situ probe
• Alt name: Nnmt
• Alt name: nicotinamide N-methyltransferase
• Species: M. musculus (mouse)
• Insert Size (bp): 455
• Mutation: fragment contains bp# 454-908 of NM_010924.2
• GenBank ID: NM_010924
• Entrez Gene: Nnmt

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Nnmt fragment was amplified by RT-PCR using the following primer pair:
CCTATGTGTGTGATCTTGAAGG
AGATCTGCCTGGCTTTCG

For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 454-908 of NM_010924.2 (and contain a single nucleotide mismatch at bp#816), not bp# 529-983 as indicated on plasmid map. The plasmid functions as described in the associated publication.